CRISPRscan
CRISPRscan is a novel algorithm to predict gRNA efficiency.
Based on a large scale analysis of sgRNA mutagenesis activity in zebrafish, we established rules to predict sgRNA activity in vivo and build the CRISPRscan model integrating these rules. We independently validated with success our predictions using sgRNAs different from the large scale analysis.
Off-target predictions
CRISPRscan searches for potential genomic off-targets with the following rules.
Cas9
- All
- According to Hsu et al. Nature Biotechnology 2013, potential off-targets can have a maximum of 2 mismatches with the sgRNA.
- Seed
- With the method published by Cong et al. Science 2013, potential off-targets must match perfectly in their seed (12 nt 3’ of the PAM sequence) and a maximum of 2 mismatches in the rest of the sgRNA. This rule is more stringent than the All method and therefore less off-targets are found.
- CFD (Cutting Frequency Determination)
- Doench et al. Nature Biotechnology 2016 measured the cutting efficiency of potential off-targets and integrated them into the CFD score. Potential off-targets with up to 4 mismatches are scored with Doench et al. matrix.
Cpf1
- All
- Potential off-targets can have a maximum of 2 mismatches with the gRNA.
- Seed
- The experiments published by Kim et al. Nature Methods 2017 support potential off-targets that must match perfectly in their seed (6 nt 3’ of the PAM sequence) and a maximum of 2 mismatches in the rest of the gRNA. This rule is more stringent than the All method and therefore less off-targets are found.
gRNA generation
Detailed information can be found in our protocols:
- For Cas9: Optimized CRISPR–Cas9 system for genome editing in zebrafish
- For Cas12a: Optimized CRISPR-Cpf1 system for genome editing in zebrafish
Cas9
| Oligo sequences | |||
|---|---|---|---|
| Oligo 1. sgRNA primer | T7 promoter | Target sequence | Tail annealing sequence |
| 5’ TAATACGACTCACTATA | GGNNNNNNNNNNNNNNNNNN | GTTTTAGAGCTAGAA | |
| alternative promoter | Sp6 promoter | ||
| 5’ ATTTAGGTGACACTATA | GANNNNNNNNNNNNNNNNNN | GTTTTAGAGCTAGAA | |
| Oligo 2. Tail primer | Tail | Tail annealing sequence | |
| 5’ AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTAT | TTCTAGCTCTAAAAC | ||
Cpf1
| Oligo sequences | ||
|---|---|---|
| LbCpf1 | ||
| Oligo 1. Tail primer | T7 promoter | Tail sequence |
| 5’ CCCTAATACGACTCACTATA | GGTAATTTCTACTAAGTGTAGAT | |
| Oligo 2. crRNA primer | Target sequence (reverse) | Tail sequence |
| 5’ NNNNNNNNNNNNNNNNNNNNNNN | ATCTACACTTAGTAGAAATTA | |
| AsCpf1 | ||
| Oligo 1. Tail primer | T7 promoter | Tail sequence |
| 5’ CCCTAATACGACTCACTATA | GGTAATTTCTACTCTTGTAGAT | |
| Oligo 2. crRNA primer | Target sequence (reverse) | Tail sequence |
| 5’ NNNNNNNNNNNNNNNNNNNNNNN | ATCTACAAGAGTAGAAATTA | |
| NB | ||
| ||
Genomes and genes
Sequences of genomes and annotations of genes were obtained from these sources:
| Name | Source | Assembly | |
|---|---|---|---|
| Arabidopsis thaliana | Arabidopsis thaliana | Ensembl genomes 59 | TAIR10 |
| Cow | Bos taurus | Ensembl 112 | ARS-UCD1.3 |
| Worm | Caenorhabditis elegans | Ensembl 112 | WBcel235 |
| Marmoset | Callithrix jacchus | Ensembl 112 | mCalJac1.pat.X |
| Ciona | Ciona intestinalis | Ensembl 112 | KH |
| Zebrafish | Danio rerio | Ensembl 112 | GRCz11 |
| Zebrafish NHGRI (SNP only) | Danio rerio | Nhgri | GRCz11 |
| Fly | Drosophila melanogaster | Ensembl 112 | BDGP6.46 |
| Chicken | Gallus gallus | Ensembl 112 | bGalGal1.mat.broiler.GRCg7b |
| Soybean | Glycine max | Ensembl genomes 59 | Glycine_max_v2.1 |
| Human | Homo sapiens | Ensembl 112 | GRCh38 |
| Green sea urchin | Lytechinus variegatus | Ensembl genomes 59 | Lvar_3.0 |
| Sea walnut | Mnemiopsis leidyi | Ensembl genomes 59 | MneLei_Aug2011 |
| Mouse | Mus musculus | Ensembl 112 | GRCm39 |
| Sea anemone | Nematostella vectensis | Ensembl genomes 59 | ASM20922v1 |
| Killifish | Nothobranchius furzeri | Brunet | NotFur1 |
| Rice | Oryza sativa | Ensembl genomes 59 | IRGSP-1.0 |
| Medaka | Oryzias latipes | Ensembl 112 | ASM223467v1 |
| Chimpanzee | Pan troglodytes | Ensembl 112 | Pan_tro_3.0 |
| Bat star | Patiria miniata | Ensembl genomes 59 | Pmin_3.0 |
| Sea lamprey | Petromyzon marinus | Stowers | kPetmar1 |
| Apple snail | Pomacea canaliculata gca003073045v1 | Ensembl genomes 59 | ASM307304v1 |
| Rat | Rattus norvegicus | Ensembl 112 | mRatBN7.2 |
| Yeast | Saccharomyces cerevisiae | Ensembl 112 | R64-1-1 |
| Sorghum | Sorghum bicolor | Ensembl genomes 59 | Sorghum_bicolor_NCBIv3 |
| Purple sea urchin | Strongylocentrotus purpuratus | Ensembl genomes 59 | Spur_5.0 |
| Frog | Xenopus laevis | Xenbase | Xenopus_laevis_v10.1 |
| Frog | Xenopus tropicalis | Ensembl 112 | UCB_Xtro_10.0 |
| Corn | Zea mays | Ensembl genomes 59 | Zm-B73-REFERENCE-NAM-5.0 |
Plasmid: Cas9 with nanos 3’-UTR
Plasmid for targeting Cas9 expression into the germ line is available at Addgene.